alexametrics
mardi 01 décembre 2020
Heure de Tunis : 03:41
Tribunes
Covid-19 : Les implications des nouveaux vaccins à ARNm
17/11/2020 | 12:41
8 min
Covid-19 :  Les implications des nouveaux vaccins à ARNm

 Par Lassaâd M’sahli*

 

La Covid-19 causée par le SRAS-Cov-2, coronavirus émergé à la fin de 2019 et disséminé à l’échelle mondiale a encouragé l’effort d’accélérer le développement de vaccins. Leur production se base sur l’utilisation d’un virus mort ou vivant et atténué ou modifié ou encore se base sur le patrimoine génétique de type ADN[1] (Acide Désoxyribonucléique) ou ARN[2] (Acide Ribonucléique). La nouvelle classe de vaccins se base sur l’ARNm[3] (Acide Ribonucléique Messager).

Les trois méthodes sont les suivantes.

La première méthode se base sur l’inactivation des virus selon le type soit en utilisant des produits chimiques (des détergents ou des solvants comme l’éther), soit en utilisant la chaleur (Pasteurisation) soit en agissant sur le pH (l’acidité inactive les virus). Cette première méthode est la plus classique, la plus sûre, la moins coûteuse et la plus recommandée. Elle garantit l’égalité d’accès au vaccin et convient à une vaccination de masse. Les deux vaccins chinois qui sont produits selon ce protocole sont administrés en Chine, aux EAU (Sinovac) et au Maroc (Sinopharm).

La deuxième méthode d’élaboration de vaccin est de faire des manipulations de génie génétique sur des virus pour produire un organisme génétiquement modifié (OGM) qui produit l’immunité sans déclencher la maladie. Ce vaccin est dit recombinant. Cette méthode a été adoptée par les chinois, les Russes (Sputnik 5), AstraZeneca et Johnson&Johnson. Les chercheurs manifestent une certaine prudence vis-à-vis de cette méthode en raison du risque de mutation de ces OGM.

La troisième méthode et la plus récente. Elle accuse un retard par rapport aux deux premières qui sont en compétition et pose un sérieux problème technique et logistique. Elle convient pour les pays riches qui semblent être privilégiés car ils disposent des infrastructures et des moyens techniques et financiers. Cette méthode convient beaucoup plus pour une vaccination de petits groupes de personnes. Elle est adoptée par les laboratoires Pfizer et Moderna.

En l’absence du recul scientifique nécessaire, il n’y a pas encore de certitudes concernant la durée de l’immunité produite, car il n’a y pas de données sur la nature de la réponse immunitaire si elle déclenche une sécrétion d’anticorps accompagnée d’une stimulation des cellules immunitaires (lymphocytes, et macrophages) ou non. C’est cette double immunité qui définit l’immunité artificielle induite par le vaccin.

Limites d’accès aux médicaments ou « simple exclusion »

La stratégie de lancement des nouveaux vaccins ARNm comporte une double exclusion. La première exclusion cible les éventuels concurrents. Elle est exercée en faisant valoir ses droits de propriété intellectuelle qui permettent à leur titulaire d’exclure les tiers de l’exploitation d’une innovation technologique et de profiter d’un monopole exclusif durant 20 ans au moins. Elle s’opère par voie de justice pour faire respecter les droits de propriété intellectuelle. C’est le cas de Moderna qui vient de perdre son procès contre Arbutus Biopharma (ABUS) concernant l’utilisation des nanoparticules lipidiques (LNDPs) destinées à véhiculer les principes actifs (les médicaments) à l’intérieur des cellules.

La seconde exclusion cible les pays pauvres au moyen du prix et des conditions technologiques de type « deep freeze » (congélation à -80°C). Elle peut se faire entre autres par la définition des régimes logistiques (logistique de la chaine du froid) d’un produit pharmaceutique. Elle fixe sa trajectoire de commercialisation et limite son marché. Cette dynamique sert aussi, les stratégies marchandes ainsi que la perpétuation à la fois du système d’injustice et de l’injustice du système qui s’expriment à travers les politiques des prix et la conception de la propriété rendant certains traitements inaccessibles.

De telles innovations s’accompagnent d’un faisceau d’innovations parallèles dans d’autres domaines connexes comme celui du transport en « deep freeze », une technologie développée par UPS ou celle de la neige carbonique dont le renouvellement est nécessaire pour maintenir la température près de -73°C et qui est développée par une autre firme allemande.

Après cet aspect général présentant quelques particularités aboutissant à des inégalités, la possible orientation du marché du médicament et l’organisation de son régime logistique, j’évoquerai certains questionnements spécifiques au nouveau vaccin ARNm.

L’annonce :

Les Laboratoires Moderna et Pfizer se sont lancés dans le processus de fabrication du nouveau vaccin à ARNm. Moderna n’a pas encore fait d’annonce contrairement à Pfizer qui l’a annoncé dans un communiqué de presse le 9 novembre 2020. Communiqué qui semble bien programmé. Le CEO et d’autres premiers responsables auraient anticipé l’annonce de vente d’une part importante de leurs actions. Ce qui les éloigne de l’acte de délit d’initié. Ce communiqué de presse a pu profiter au CEO (M. Burla) qui a vendu 60% de ses actions (132 508 actions à 41.94 USD le lundi 9/11/2020) qu’il détenait dans le laboratoire qu’il dirige pour une valeur 5.6 millions de dollars. L’autre responsable (Executive Vice-President) à Pfizer, Sally Susman a vendu aux alentours de 1.8 millions de dollars soit 43 662 actions. L’action Pfizer a augmenté de 7% puis à 15% durant la même journée. Cet épisode est loin d’être isolé. Il fait partie d’une série de spéculations boursières et financières qui caractérise cette industrie et qui se fait au détriment de la santé publique.

Un vaccin innovant : « Primum non nocere »

Le vaccin est certes innovant car il est le premier vaccin utilisant l’Acide RiboNucléique messager (ARNm). Juan Gervas a analysé les données disponibles et relatives au risque relatif (90%) pour 86 cas Covid correspondant au groupe Placebo de 21 764 sujets contre 8 cas Covid pour le groupe vacciné de comportant 21 764 sujets. Il constate que le risque absolu noté est de 0,35%. Il rappelle dans ce cadre, qu’en matière de prévention des maladies, il ne faut avoir ni décès, ni complications. Plusieurs inconnues demeurent saillantes comme le mécanisme de prévention des maladies sévères, ou l’action du vaccin sur les différents sous-groupes, ou comment le vaccin prévient-il les décès ou l’infection chez les personnes vaccinées et chez la population (immunité de groupe). La durée de la réponse immunitaire est une autre inconnue tout comme les effets indésirables. La même « ignorance » concerne le coût du vaccin, celui de son transport en conditions de « deep freeze » (-80°C) et de son utilisation dans les circuits sanitaires. De tels équipements spéciaux et spécifiques restent exclusifs à certaines armées, or nous savons que les circuits de santé majoritairement couverts, sont dans le secteur privé et ne peuvent disposer des équipements nécessaires au maintien de cette chaine de froid extrême. Ce qui évoque des défis supplémentaires.

Les autorisations de mise sur le marché (AMM) accélérées octroyées malgré le faible recul scientifique et sécuritaire augmentent, d’une part, les risques d’accidents thérapeutiques pour les sujets vaccinés et d’autre part elles augmentent aussi les risques de poursuites professionnelles, civiles et pénales pour les décideurs politiques et administratifs et pour les experts dans le cadre de la responsabilité médicale et l’indemnisation des malades victimes de tels accidents. Les cas du Vioxx, du Mediator et de la Dépakine sont encore récents.

L’éthique en question :

La première question est comment assurer la difficile équation de définir les bonnes personnes (justes) pour avoir le bon vaccin au bon moment. L’échec relatif du vaccin de la grippe évoque l’échec attendu du vaccin de la Covid, en particulier dans les pays à moyens et à faibles revenus, dans un contexte de difficultés structurelles qui affectent leurs systèmes d’information sanitaire d’une part et dans le contexte de mutations spécifiques aux coronavirus, d’autre part. On évoque de manière très voilée l’absence probable d’immunité croisée entre les nouvelles variantes du SRAS-CoV-2.

La seconde question concerne la distribution équitable du vaccin. Elle nécessite une planification vaccinale et une identification prioritaire de la population vulnérable. Ce qui nécessite une transparence permettant un accès équitable et expliquant au citoyen de comprendre qui recevra le vaccin en priorité et qui sera différé. La transparence ou le manque de transparence permettent de mesurer l’accès ou le manque d’accès aux soins, déterminant de la sorte, un indicateur de la marginalisation des populations. Le manque de transparence réduirait aussi la crédibilité et l’utilité du vaccin.

Les risques : Mauvaise gouvernance, vols, liens et conflits d’intérêts, corruption, perte de l’indépendance

Les autres vaccins suscitent une faible valeur de la rue. Cependant, la demande de certains vaccins pouvant exalter l’immunité comme le BCG, le Pneumovax ou le Vaxigrip est en hausse de manière inédite.

La demande de vaccin contre la Covid-19 suit cette tendance haussière sous l’impulsion de l’anxiété et la panique dans lesquelles se trouve la population et qui motiveront le vol, la corruption et l’introduction de faux vaccins. Ceci aurait un impact dévastateur, une augmentation du scepticisme, une aggravation de la pandémie et une augmentation des décès.

La militarisation du vaccin transforme ce dernier en une arme géostratégique qui permettra aux pays riches de tisser de nouvelles alliances entre eux et d’appliquer plus facilement leurs politiques publiques géostratégiques de domination sur les pays moins riches et pauvres. La vocation des vaccins a changé. Désormais, ces derniers sont motivés par le nationalisme et la valeur commerciale beaucoup plus que la valeur scientifique et thérapeutique.

Le droit à la Santé, est l’un des droits fondamentaux de l’Homme

Le retard de traitement et/ou de vaccination augmenterait la souffrance économique, psychologique et sociale. Il augmenterait aussi le désespoir des citoyens et le risque d’aggravation pandémique.

La solution ne peut venir que de la préparation d’une planification transparente, une amélioration des performances du système de santé et du renforcement des chaines de distribution devant être robustes et fiables.



[1] L’ADN appelé est une grosse molécule à double brins. Il est aussi appelé génome. Il contient tous les informations génétique d’un être vivant et lui permet de se développer, de fonctionner et de se multiplier.

[2] L’ARN est très proche de l’ADN. Il peut en être une copie à simple brin.

[3] L’ARNm est une copie d’une portion d’n brin d’ADN qui en se liant au ribosome (organite cellulaire du cytoplasme) déclenche la synthèse d’une protéine.

 

 

 *Pharmacien-Clinicien, Pharmacoéconomiste, Chercheur en Droit de la Gouvernance

17/11/2020 | 12:41
8 min
Suivez-nous
Commentaires
Dr. Jamel Tazarki
@Forza
a posté le 29-11-2020 à 21:58
le petit bricolage que je viens de décrire ci-dessous n'est que le cours de biologie moléculaire en classe de terminal en Allemagne :)

vous écrivez "On ne peut pas copier le travail des autres sans leur autorisation" -->
non, on ne copie absolument rien, ce sont des connaissances que l'on apprenne à l'école secondaire...

Il faut comprendre enfin, qu'il y a un changement de paradigme...


Forza
@Dr. Jamel Tazarki, il faut commencer petit
a posté le 29-11-2020 à 19:42
Comme on a bien vu. Il y'a seulement quelques pays qui disposent de la technologie et du savoir pour développer de tels médicaments, les français par exemple n'ont pas encore abouti à un vaccin de leur propre développement. Il y'a une opportunité pour la Tunisie, pourquoi ne pas entrer en partenariat avec ces labos pour faire de la Tunisie une plateforme pour l'Afrique. On ne peut pas copier le travail des autres sans leur autorisation, sinon on s'isole nous-même.
On peut déjà commencer par développer quelques aspects en sub contractors pour développer un tissu scientifique et industriel. Je suis surpris par quelques tunisiens qui attaque Mr. Louzir de l'institut pasteur car un vaccin tunisien n'est pas prêt. Ces gens sous-estiment le travail à faire. Mr. Loutir a parlé d'un vaccin a base d'un vaccin contre la rage que l'institut a développé il y'a des années. C'est un bon travail pour apprendre mais ce n'est pas fair de demander à l'institut pasteur de Tunisie de battre des labos américains ou européens, faut être réaliste.
Bonne soirée.
Dr. Jamel Tazarki
@Forza
a posté le 29-11-2020 à 19:18
Très Cher Compatriote Forza,
je suis convaincu que l'on pourrait fabriquer le vaccin à base d'ARN par nous même en Tunisie:
1) Nous achetons un seul vaccin des laboratoires Pfizer et Moderna afin d'avoir l'ARN de la protéine Spikey --> la Solution la plus simple et la moins chère afin d'avoir cette "fameuse" ARN:)
2) nous faisons multiplier l'ARN de la protéine spikey par polymérase (en rajoutant des enzymes), un processus trop simple où il ne faut pratiquement rien faire--> production de milliards d'ARN
3) nous mélangeons ces milliards d'ARN avec des bactéries,
4) l'ARN de la protéine spikey s'infiltre par elle même dans le micro-organisme de la Bactérie à travers les récepteurs de ces dernières. Et ainsi elles produisent la protéine spikey --> Il ne faut vraiment rien: l'ARN s'infiltre par elle même dan le micro-organisme de l a Bactérie qui produit par elle même la protéine spikey --> Franchement, c'est rien de magique:)
5) la protéine spikey pourrait être récoltée puis purifiée pour sa mise sur le marché en tant que vaccin à 20 centimes la pièce :)

Le risque est vraiment minime/négligeable:
Par analogie, les protéines d'un fruit exotique inconnues à notre système de défense pourraient provoquer la production inutile d'anticorps et des allergies, mais aucune personne ne serait en danger de mort pour avoir mangé un fruit exotique... Il faut savoir limiter la dose et éviter la surdose...


je conseille de lire mes commentaires ci-dessous afin de comprendre celui-ci


Fazit: il y a un changement de paradigme et il faut que les pays sous-développés prennent les raccourcis afin de rattraper leur retard


@M. Louzir, Le DG de l'Institut Pasteur: oui notre Institut Pasteur serait capable de produire le vaccin à base d'ARN --> It's time to break our limits


Bonne soirée

Dr. Jamel Tazarki, Mathématicien

PS: j'ai travaillé pour plusieurs laboratoires de la biologie moléculaire en Allemagne en tant que mathématicien (freelancer). J'utilise Bioperl pour l'analyse et le décodage des
séquences génétiques et leur récupération à partir de bases de données publiques. --> J'ai tout appris sur le web, il faut seulement savoir lire correctement'?' Oui, la meilleure académie est le web, YouTube et Google'?' Il faut seulement savoir les utiliser intelligemment'?' au diable avec certains (je dis bien certains et pas tous) diplômes universitaires à la con'?'
Forza
@Mr. M'Sahli, je ne comprends pas votre raisonnement
a posté le 29-11-2020 à 18:34
Vous ne voyez pas l'intérêt d'un vaccin car le virus fait des mutations ? oui mais ceci s'applique aussi à d'autres virus, ceux de la grippe saisonnière par exemple. Une fois, les laboratoires ont développé un vaccin, ils vont pouvoir l'adapter aux mutations et ils sont conscients de ce risque.
Et bien sûr toute nouvelle technologie présente des risques car on ne peut analyser les implications à long terme qu'après avoir fait les études post vaccination mais ceci s'applique aussi aux nouveaux médicaments. C'est toujours un arbitrage entre les risques possibles et les avantages, est-ce qu'on risque plus de malades graves et de morts sans vaccination ou est-ce qu'on risque plus de complications à long terme et les décès ne sont pas seulement parmi les plus âgés, la moyenne d'âge des décédés en Tunisie est moins que 50 ans et toute vie compte pour dire que c'est faux de penser que c'est seulement un problème des vieux.
Cela dit, je pense que l'idée originale de dire qu'il faut commencer par les groupes a risque est risquée à mon avis. Il faut plutôt commencer la vaccination par les jeunes et les allemands et les anglais ont maintenant décidé de commencer par le corps de sante mais sans obligation faite a personne.
Sinon pour les tests cliniques, ils ont été faits en majorité dans des pays plutôt développés, BionTech par exemple a testé aux Etats-Unis, en Allemagne, au Brésil, en Argentine et en Turquie donc votre accusation de test sur des pauvres n'est pas correcte. En Allemagne il y'avait plus de volontaires que la capacité du programme. Il ne faut pas voir des complots partout.
D'ailleurs l'Afrique à part l'Afrique du sud n'est pas très impactée donc ça n'a pas de sens pour les labos de faire leurs tests en Afrique car ils ont besoin de pays avec grande population et où le virus fait des ravages pour tester l'efficacité (car éthiquement il est interdit d'infecter quelqu'un après l'injection du vaccin). Le taux d'efficacité calculée par Moderna, BionTech et AstraZeneca est déduit du nombre de ceux vaccinés et qui ont attrapé la maladie par rapport à ceux qui n'ont eu qu'un placebo.
Sinon pour le stockage, ce n'est pas un problème insurmontable même pour des pays en voie de développement. En Tunisie par exemple, on peut installer ces équipements directement dans les aéroports et installer des centres de vaccination dans les aéroports (Tunis, Monastir, Djerba, Tabarka, Gafsa, Gabes, Remada) et dans les hôpitaux universitaires. Avec 20 centres et 1500 vaccinations par jour, on peut vacciner 5.4 Millions sur 12 mois. Selon les déclarations du ministres 12% des tunisiens ont eu COVID, donc ces derniers n'ont pas besoin de vaccin.
Le vaccin d'AstraZeneca n'a pas besoin d'une logistique performante donc on peut utiliser les cabinets de médecins et les pharmacies pour ce vaccin. En fin de compte, on va avoir besoin de plusieurs vaccins car si l'efficacité des vaccins Moderna et Biotech est plus élevée que celle d'AstraZeneca (95% et 70&%), il va falloir réserver ces vaccins couteux aux plus âgés, patients a risque, médecins et infirmiers et vacciner la masse avec AtraZeneca.
Forza
@Dr. Jamel Tazarki, je ne partage pas votre avis cette fois ci
a posté le 29-11-2020 à 17:58
Les américains par exemple n'obligent pas les autres pays à déposer leurs médicaments ou vaccins auprès de la FDA pour recevoir un « approval ». Ils disent juste que si vous voulez commercialiser le médicament ou vaccin en Amérique, vous devriez passer par la FDA. Cette FDA a fondé sa réputation sur un travail de dizaines d'années pour arriver à développer les procédures de rigueur de tests et de validation.
Maintenant pour la Tunisie et nos entreprises, ou bien on suit cette voie et on peut commercialiser sur les marchés mondiaux ou on reste isolés avec nos propres normes et les risques pour notre propre population. Je ne pense pas que nous avons les capacités pour remplacer le travail fait par une FDA
Forza
@Anyssa ' Sans les médicaments et les vaccins l'espérance de vie a la naissance ne serait que de 45 ans
a posté le 29-11-2020 à 17:47
Nos ancêtres ne vivaient pas plus que 40 ou 50 ans en moyenne (consultez la courbe sous le lien en bas).
Pour le prix du vaccin, il n'est nullement de 50 Euro. L'union européenne paye entre 12.5 et 15 Euro pour le vaccin de BionTech et va payer entre 10 Euro et 12.5 Euro pour le vaccin de Curevac. AztraZeneca veut proposer son vaccin à 2.5 Euro mais ses coûts de production sont aussi moins élevés- Les pays en voie de développement vont payer des prix moins élevés que ceux payés par l'union européenne et les Etats-Unis et l'OMS a déjà collecte plus que 6 milliards d'aides pour le financement de son programme pour les pays pauvres, la plupart de ses aides viennent d'Europe et des Etats-Unis, le Japon et un peu de pays du golfe (Arabie Saoudite a versé 500 millions de $).
Sinon la Tunisie enregistre chaque jour entres 40 et 70 décès.
Lien évolution de l'espérance de vie a la naissance en Tunisie :
https://perspective.usherbrooke.ca/bilan/tend/TUN/fr/SP.DYN.LE00.IN.html
Forza
Mr Mshali part d'une position critique vis-à-vis des laboratoires
a posté le 29-11-2020 à 17:32
Ce n'est pas mal comme position pour garder sa précaution mais une telle position peut rendre aussi peu objectif. Une phrase de l'article est à mon avis scientifiquement non correct. Mr. Mshalli avance que 'La troisième méthode et la plus récente. Elle accuse un retard par rapport aux deux premières qui sont en compétition'. Ceci n'est pas correcte car les deux vaccins les plus avancés, celui de BionTech et celui de Moderna sont basés sur cette technologie. Son avantage précisément, c'est qu'elle accélère le processus de développement de vaccins.
Concernant le vaccin russe, il est passé directement à une phase de commercialisation sans phase II ou III. D'ailleurs le porte-parole de Putin a déclaré que ce dernier ne va pas se vacciner avec le vaccin de son propre pays car pas encore approuvé.
Le vaccin chinois lui et malgré quelques publications, n'a pas déposé une demande d'autorisation auprès de la FDA américaine, la plus reconnue au monde et ceci pour son track record et son sérieux.
Mr. Msahli décrit le challenge du storage a une très basse température comme si c'etait voulu par les laboratoires pour privilégier les pays disposants de telles infrastructures, ce n'est pas correcte car c'est un inconvénient pour la commercialisation. Le laboratoire Biontech travaille déjà sur une optimisation pour résoudre ce problème.
Enfin présenter les laboratoires comme des monstres qui ne veulent faire que du fric, n'apporte rien à l'humanité car sans le travail des ces laboratoires, on n'aura ni vaccins et ni de nouveaux médicaments. D'ailleurs les laboratoires ne font plus de recherches dans les antibiotiques par exemple car ils risquent de ne pas couvrir leurs coûts.
BionTech par exemple vient du domaine de la recherche de médicaments contre le cancer. Dans une interview, le CEO annonce que les profits de la commercialisation du vaccin COVID-19 va aider aussi la recherche de nouvelles thérapies de traitement de cancer par exemple celui du cerveau. AstraZeneca va vendre son vaccin sans profits.
En fin une nouvelle est passée presque inaperçue. BionTech qui a remporté la course au vaccin COVID-19 a signé un contrat avec une startup tunisienne INSTADEEP pour l'utilisation de leurs solutions d'intelligence artificielle dans leurs recherches oncologiques. Voilà une belle nouvelle que les médias tunisiens (à part BN, bravo) et l'état tunisien n'ont pas bien promu. C'est une référence fantastique pour attirer des investissements dans le domaine des TICs.
Anyssa
Réponse@ salahtataouine| 22-11-2020 10:10
a posté le 23-11-2020 à 23:52
Bonsoir Salahtataouine|
merci pour votre lien qui nous éclaire.
Nous passons de Big Pharma à Big Science Business...nos vies sont cotées en bourse...nos gouvernements sont complices de cette supercherie mondiale ..des milliards de vaccins achetés à 50e la dose et fabriqués à un prix de revient à 1,50e...voyez un peu la marge et le bénéfice...imaginez les dividendes et la bourse qui s'enflamme...sans parler de la merde qui est contenu dedans...alors que naturellement nous sommes capables de faire face à TOUTES les maladies naturelles...notre corps est capable de produire ce qu'il faut pour se défendre et résister...mais depuis que l 'homme a commencé à manipuler la maladie, il a appris à l'inventer et à en jouer avec et à nous l'inoculer !!!
Voici un lien qui en dit long, il faut vraiment écouter cela attentivement :

Des dieux et des inutiles - conférence de Laurent Alexandre à ...www.cielterrefc.fr '?' des-dieux-et-des-inutiles-conferenc...

Bonne nuit !
salahtataouine
Selon l OMS
a posté le 22-11-2020 à 10:10
38 candidats vaccins font l objet d essais cliniques de phase 1 2 et 3 six utilisent le virus inactivé les autres reposent sur des approches biotechniques et consistent à injecter a) une proteine du virus (antigene) b)des particules pseudo virales c) l ADN ou L ARN codant l antigene
la suite ici https://twitter.com/CorinneReverbel/status/1330191203158159360/photo/3

Pour revenir à ce que vous dites DOC Jamel """"je me demande ainsi, pourquoi ne pas laisser des bactéries produire la protéine spikey et de l'injecter par la suite chez les êtres humains en tant que vaccin? Plutôt que de laisser la cellule humaine fabriquer la protéine spikey en lui injectant l'ARN du virus corona...""""""""""" vous posez la bonne question mais c est la reponse qui est "dangereuse " ..les labos ne veulent pas se mouiller car ca coute cher mais surtout les effets qui nous assure que cette injection produira ce que on "veut" ..je ne le crois pas car on peut en avoir de trop ou pas assez et en plus ca va etre dans nos genes sur des generations ...alors un vaccin NON MERCI
salahtataouine
A voir !!
a posté le 22-11-2020 à 09:44
https://twitter.com/CorinneReverbel/status/1330191203158159360/photo/3
DHEJ
@Anyssa
a posté le 21-11-2020 à 16:00
Les vaccins serviront à faiter Valentine's day !


Anyssa
PERVERSION PLANETAIRE..
a posté le 21-11-2020 à 15:27
Lorsque la science s'accoquine à l'économie / business, elle finit par se pervertir !!!

Bienvenue au meilleur des mondes...les vaccins sont mis en place pour cela..dont voici le lien ( copier / coller ) :

Global Positive Forum - Positive Planetpositiveplanet.ngo '?' global-positive-forum
GLOBAL POSITIVE FORUM. Gabriel García Márquez, en visite à Paris en 1999, avait prédit : « N'attendez rien du XXI e siècle'?' parce que le XXI e siècle attend ...

ET le français qui vous racontera la messe de ce nouveau monde est Laurent Alexandre...

OUVREZ BIEN VOS YEUX, VOS OREILLES et surtout VOTRE CERVEAU..
Vous finirez bien par comprendre à quoi vont servir ces vaccins..et leur réel objectif.
Dr. Jamel Tazarki
@Mr. salahtataouine && Mr. Lassaâd M'SAHLI
a posté le 21-11-2020 à 11:23
Très Chers Compatriotes,

Il est temps que l'on comprenne enfin que la solution de la pandémie du virus Corona ne peut-être qu'à l'échelle planétaire --> tous les pays du monde sans exception, toutes les religions du monde sans exception, tous les athées du monde sans exception , toutes les races du monde sans exception ont compris que s'il restait un seul être humain quelque part sur notre planète porteur du virus, la pandémie reprendrait de nouveau son invasion/ravage en quelques semaines (propagation exponentielle).
-->
De ce fait: les Français, les Allemands, les Japonais, les Israéliens, les Américains, les russes (etc., etc., etc.) n'ont pas d'autres choix que de fournir le vaccin contre le virus corona aux pays sous-développés même à zéro euro. Car (je me répète) si un seul être humain restait quelque part sur notre planète porteur du virus, la pandémie reprendrait de nouveau son invasion/ravage en quelques semaines (propagation exponentielle).

@Salahtataouine, L'idée du vaccin à base d'ARN est très simple:
1) -la protéine spikey permettrait au virus corona de pénétrer la cellule humaine par l'un de ses récepteurs.
2) en général: Lorsqu'un microbe (virus, bactérie, parasite'?') pénètre dans l'organisme, le système immunitaire détecte la présence de composants étrangers à l'organisme que l'on appelle antigènes. Notre système de défense reconnaît les antigènes comme intrus et cherche donc à les éliminer, en fabriquant des anticorps. Dans certains cas, le microbe pathogène peut déclencher une maladie grave car la production d'anticorps protecteurs nécessite du temps.
2) un vaccin qui contiendrait la protéine spikey du virus corona serait incapable de provoquer la maladie --> par contre la protéine spikey se comporterait comme un antigène et entraîne la production d'anticorps qui vont persister de nombreuses années (ou mois) dans notre corps. Si le virus corona se présente en entier ("et non pas en pièces détachées") , il serait détruit par les anticorps produits au moment de la vaccination et la maladie serait évitée.

Voilà ce que propose les laboratoires Pfizer et Moderna: ils voudraient injecter dans le corps humain l'ARN responsable de la production du gène spikey en tant que vaccin:
a) L'ARN injecté s'infiltre dans la cellule humaine par l'un de ses récepteurs ("c'est sa spécialité"),
b) Le ribosome de la cellule humaine en fabrique la protéine spikey
c) Notre système de défense reconnaît les antigènes spikey comme intrus et cherche donc à les éliminer, en fabriquant des anticorps.
d) Les anticorps vont persister de nombreuses années (ou mois) dans notre corps --> Si le virus corona se présente en entier ("et non pas en pièces détachées") , il serait détruit par les anticorps produits au moment de la vaccination et la maladie serait évitée.


je me demande ainsi, pourquoi ne pas laisser des bactéries produire la protéine spikey et de l'injecter par la suite chez les êtres humains en tant que vaccin? Plutôt que de laisser la cellule humaine fabriquer la protéine spikey en lui injectant l'ARN du virus corona...

Il suffit de penser par analogie au procédé de fabrication de l'insuline par les bactéries. Le gène qui donne les instructions pour fabriquer l'insuline humaine est d'abord inséré dans le micro-organisme. Et ainsi la bactérie produit l'insuline qui par la suite sera récoltée puis purifiée pour sa mise sur le marché

De manière générale, une protéine peut être conservée jusqu'à 2 ans environ, si on la conserve dans un endroit frais et sec. Alors que le vaccin proposé par Pfizer Moderna qui contiendrait l'ARN de la protéine spikey s'abîmerait en quelques jours ou même quelques heures (c'est une suite de base trop fragile --> d'où la nécessité de la conserver à -20°C ou même -80°C)

Bonne journée

Dr. Jamel Tazarki, Mathématicien


Remarque (hors sujet) : d'ailleurs, il est même conseillé de manger les produits végétaux locaux, car les fruits exotiques qui contiennent des protéines inconnues à notre système de défense pourraient provoquer la production inutile d'anticorps et des allergies (--> plutôt manger des figues que des noix de coco, en Tunisie)
Lassaâd M'SAHLI
@Dr Jamel Tazarki
a posté le 19-11-2020 à 13:18
Cher Dr Tazarki, je vous remercie pour votre contribution et pour les alternatives que vous proposez. Plus que la critique, ce qui m'importe c'est l'objectivisme. Ce n'est pas une question de manque d'ingéniosité, c'est une question d'une position stratégique de domination de l'environnement économique, politique, bureaucratique et scientifique. Malheureusement, cet environnement est totalement gangréné et corrompu. Vos idées aussi pertinentes et originales soient-elles, elles ne verront le jour que lorsque vous allez emprunter leurs circuits de décision et d'expertise (leur bureaucratie). C'est ce que Ali Aïdi appelle "noopolitique". Comme le secteur pharmaceutique est hyper-réglementé, tout se fera selon leurs normes et selon les autorisations administratives (vous savez comment ça se passe). Ces deux aspects de la capture réglementaire sont appelées par l'Economiste Jean-Cartier Bresson "illégalités normalisées". Sur un plan pratique, il y a un système technico-administratif qui dépend des politiques publiques où les relations politiques et diplomatiques(Ambassades) ont un poids majeur. Rien ne se fera de votre projet car vous aurez contre vous toute la diaspora de leurs collaborateurs, disséminée dans l'administration, dans le milieu académique (Revues scientifiques, hospitalo-universitaires et investigateurs cliniques) et auprès des professionnels indépendants (Experts, Avocats, Experts Comptables, Pharmaciens,...). Pour vous donner une image, le système décisionnel en vigueur est très semble au taxiphone: le taxiphone ne fonctionne que lorsque vous y mettez quelque chose (jeton ou argent). "Pas d'intérêt, pas d'action". Donc, il faudra payer le droit de passage. C'est comme ça qu'on est passé de capitalisme sauvage au capitalisme technico-scientifique, c'est-à-dire mettre le savoir au service du pouvoir : c'est la noopolitique (forme suprême de la corruption qui permet à celle-ci de devenir légale et de taxer(au sens réel et au sens figuré) tout ce qui se fera en dehors de ce circuit d'illégal et de charlatanisme).
Cordialement.
salahtataouine
@Dr. Jamel Tazarki
a posté le 19-11-2020 à 10:27
Bonjour Monsieur Tazarki
je n ai pas vos connaissances mais ce que j ai compris le dernier vaccin de moderna veut que le corps "du vacciné" produise une souche du covid et non une souche deja existante dans le vaccin d ou le danger d une part rien ne nous dit que notre corps va produire "la souche voulue" ou plus ou pas assez et que ce mecanisme va s implanter dans notre gene et donc transmissible par notre adn
ai je bien compris ? bonne journeé à vous pour enrichir ce debat
Dr. Jamel Tazarki
@Mr. Lassaâd M'sahli
a posté le 19-11-2020 à 07:22
je vais essayer de résumer au maximum car je n'ai que 5 Minutes de temps.

vous écrivez: "La troisième méthode et la plus récente. Elle accuse un retard par rapport aux deux premières qui sont en compétition et pose un sérieux problème technique et logistique. Elle convient pour les pays riches qui semblent être privilégiés car ils disposent des infrastructures et des moyens techniques et financiers. Cette méthode convient beaucoup plus pour une vaccination de petits groupes de personnes."

--->
non, et non et non. En effet le développement du nouveau vaccin à base d'ARN est une chance pour les pays sous-développés afin de rattraper leur retard:
1) vous prenez un ARN du protéine spikey,
2) vous le multiplier par polymérase (en rajoutant des enzymes) --> production de milliards d'ARN,
3) vous mélangez ces milliards d'ARN avec des bactéries,
4) les ARN s'infiltrent dans les bactéries par leur récepteur Et ainsi elles produisent la protéine spikey qui pourrait être récoltée puis purifiée pour sa mise sur le marché en tant que vaccin à 20 centimes la pièce.

@Mr. Lassaâd M'sahli, il y a un changement de paradigme et il faut que les pays sous-développés prennent les raccourcis afin de rattraper leur retard.

@Mr. Lassaâd M'sahli, il faut que les Tunisiens fassent fonctionner enfin leurs neurones et non pas criquer éternellement l'injustice du destin et des autres...

nous allons vers un monde collaboratif et il n y a plus de secrets dans le monde scientifique, il suffit de savoir lire correctement et savoir utiliser son intelligence.

J'arrête, j'ai autres chose d'intelligent à faire

Très Cordialement

Dr. Jamel Tazarki, Mathématicien

PS: Je vous assure que l'on pourrait produire en Tunisie le vaccin à base d'ARN sans grand investissement et sans refroidissement inutile et coûteux des vaccins -80°C
hamadi
à ce faux moderna
a posté le 18-11-2020 à 09:52
d abrord,frigidaire est une marque est non appareil electromenager,la tribune de lassaad m sahli,est claire,nette et précise,sur les croisements entre finançes et santé. pour ceux qui vivent avec le progrés.....je suis retraité sur la cote d azur,né à tunis ,et ma retraite est en euros.
salahtataouine
Merci Monsieur@Lassaâd M'sahli
a posté le 17-11-2020 à 22:49
Pour votre reponse ,cela ne fera qu enrichir le debat meme pour les "non scientifiques" car une population bien informeé sera moins manipulable par la peur ou par ce virus de la peur
Detruire un pays par une "pseudo science" est criminel. et ce confinement que j ai appelé administratif depuis le debut va detruire notre economie nos petites entreprises et une grande partie de notre tissue des entrepreneurs
Mais en plus une tension entre citoyens pour un masque porté ou non
J ai eté agressé dans une administration car en sortant un employé avait vu que je ne portais pas ce dit masque..euh oui pour un oui ou un non la tension sociale se fait sentir
Merci encore pour votre eclairage
Lassaâd M'SAHLI
@Moderna
a posté le 17-11-2020 à 21:33
Non Monsieur/Madame, je n'ai pas l'esprit d'un tiers-mondiste. J'ai l'esprit d'un critique qui n'avale ni vos couleuvres ni vos boas constrictors. Je suis un fin observateur de tous les actes non-éthiques des firmes pharmaceutiques, de leurs biais et fraudes statistiques, de leur marketing illégal, de leurs essais cliniques sur les prisonniers, sur les pauvres et les oubliés, de leurs actions criminelles en bandes organisées... Si cela fait de moi un tiers-mondiste. Je le suis alors et très fièrement. Plus que vous, je suis pour le mérite et je n'aime pas les arnaques et encore moins les arnaqueurs. Ce n'est pas pour rien que l'ONU a lancé la Convention des Nations Unies Contre la Corruption, que l'OMS ait lancé en 2005 son GGMP (Good Governance of Medicines Program), que le PNUD ait lancé un programme similaire et ait promu les ilots d'intégrité, tout comme la Banque Mondiale qui a lancé Transparency International...Ci-après je vous laisse un site dans lequel vous trouverez tous les jugements prononcés par des tribunaux américains à l'encontre de l'industrie pharmaceutique ( 14 milliards USD rien que pour la période 1991-2017) (:https://www.citizen.org/article/twenty-seven-years-of-pharmaceutical-industry-criminal-and-civil-penalties-1991-through-2017/) Vous y trouverez les aspects de votre pratique quotidienne. Je vous invite aussi à lire mes autres articles vous y trouverez matière à réflexion. J'aurais souhaité avoir un débat sur le fond et non sur les fonds. Hélas,... Juste pour finir, dans le domaine de la philanthropie chaque dollars américain qui sort des USA fait un retour sur investissement de 11USD. Imaginez ce qui pourrait advenir quand il s'agit de business !
Lassaâd M'SAHLI
Réponse @Salahtataouine
a posté le 17-11-2020 à 20:48
Je vous félicite pour la pertinence de vos remarques qui se résument à 3 points essentiels:
1) A quoi sert de faire un vaccin contre un virus qui mute plus rapidement que la vitesse de production dudit vaccin? Plus encore, on ignore beaucoup de choses sur le virus et sur le vaccin. Je suis de votre avis, qu'il est trop tôt pour parler d'un quelconque vaccin qui donnera l'illusion d'être protégé et calmera la panique. Il ne servira qu'à remplir les poches des plus riches. Ceci est une suite logique de la capture systémique de l'appareil scientifique, de celui de l'expertise, de celui administratif et politique par la sphère économique qui n'y voit plus santé mais rentabilité financière.
2) Si vaccin y aura, quel vaccin aurons-nous? La Covid-19 engendre une mortalité liée à l'âge, et toute vie est précieuse. L'hypermédiatisation de décès a engendré un blocage de l'économie et de la vie sociale qui ne sera dénoué qu'avec un vaccin ou un traitement. Si j'étais responsable, pour débloquer, j'aurais choisi le vaccin du virus mort. C'est plus sûr et moins coûteux. Les Etats ont permis aux labos d'utiliser des recherches financer par des fonds publics et se sont engagés à les indemniser en cas d'accidents et de poursuites judiciaires. Donc c'est du tout bénéf pour les labos. En + ces Etats feront du vaccin leur fer de lance de leur politiques publiques pour hisser les bourses, les investissements. Tout le monde sera gagnant sur le plan économique, géopolitique, et en renommée pour les politiques et les opérateurs économiques. On sera ainsi dans le fameux contexte de noopolitique: mettre la science au service du pouvoir. Les Etats autonomes prendront la bonne décision. Les autres subiront car ils sont dépendants. C'est ce qui pousse vers le choix des nouveaux vaccins à ARNm. Bref il y a trop de politique et très peu ou pas de science.
3) Peut-on breveter l'humain? Là vous me rappelez le livre de Cecile OLIVA : Breveter l'Humain? Tout est fait par des stratagèmes comme la brevetabilité du corps humain bien que le code civil précise qu'il n'est pas une chose et ne peut donc pas être dans le commerce. Sous l'impulsion des lobbies pharmaceutiques (plus grand donateur de fonds électoraux) les législateurs des pays riches ont considéré qu'il est possible d'admettre l'admission de la brevetabilité du vivant humain car en se détachant du corps ces éléments se détachent aussi de la personne qui reste sacrée.
Dr. Jamel Tazarki
@Mr. Lassaâd M'sahli
a posté le 17-11-2020 à 20:47
Le gène qui est à l'origine de la production du protéine spikey qui permettrait au virus de pénétrer la cellule humaine par l'un de ses récepteurs est probablement le suivant (à vérifier sur une banque de génomes) :

UCAACGUUCUUCCCCGACCCGCCGGCUCCU
UGUAGCCUGCAGCAAAAGUGUCGGU


l'idée est la suivante:
on injecte chez les êtres humains l'ARN du gène qui est à l'origine de la production du protéine spikey --> Ce ARN s'infiltre (probablement) dans la cellule humaine par l'un de ses récepteurs et le ribosome de la cellule en fabrique le protéine spikey ce qui mettrait les anticorps en alerte...

la réplication de l'ARN du protéine spikey se fait en laboratoire par l'ADN polymérase --> voir le lien https://fr.wikipedia.org/wiki/ADN_polymC3A9rase

-->
ce que proposent Les Laboratoires Moderna et Pfizer est inutilement trop acrobatique. En effet, pourquoi ne pas laisser des bactéries produire la protéine spikey et de l'injecter par la suite chez les êtres humains en tant que vaccin? Plutôt que de laisser la cellule humaine fabriquer le protéine spikey en lui injectant l'ARN du virus corona...

Il suffit de penser par analogie au procédé de fabrication de l'insuline par les bactéries. Le gène qui donne les instructions pour fabriquer l'insuline humaine est d'abord inséré dans le micro-organisme. Et ainsi la bactérie produit l'insuline qui par la suite sera récoltée puis purifiée pour sa mise sur le marché.

Puis, il faut dire que l'échantillon de ceux qui ont été vaccinés par le vaccin à base d'ARN est trop petit (statistiquement non représentatif. ) afin de généraliser et tirer des conclusions utiles qui concernent des milliards d'êtres humains...

De manière générale, une protéine peut être conservée jusqu'à 2 ans environ, à condition de la conserve dans un endroit frais et sec. Alors que le vaccin à base d'ARN s'abîme en quelques jours ou même quelques heures (c'est une suite de base trop fragile --> d'où la nécessite de la conserver à moins de -80°C)

L'idée d'un vaccin à base d'ARN n'est pas une "invention" des laboratoires Moderna et Pfizer, cette idée est déjà connue depuis des décennies...

Puis qui vous dit que des morceaux d'ARN injectés dans le corps humain ne s'abîmeraient pas en grande partie avant même d'Avoir la chance de pénétrer la cellule humaine par l'un de ses récepteurs...


Fazit: l'idée d'un vaccin à base d'ARN est très bonne, mais il serait plus sûr de laisser des bactéries produire la protéine spikey et de l'injecter par la suite en tant que vaccin chez les êtres humains que de "s'amuser" à fabriquer des vaccins à base d'ARN qui seraient très difficile à conserver...

Très Cordialement

Dr. Jamel Tazarki, Mathématicien


PS: Le ribosome est la chaîne de fabrication des protéines [1] dans les cellules. Les gènes sont des portions des chromosomes, contenant l'information transmise lors de la division cellulaire. Cette information est, dans un premier temps, transcrite en brins d'ARN messager (ARNm) par l'enzyme [2] ARN polymérase. La fabrication ou traduction de la protéine débute par la fixation d'un ARNm sur le ribosome. Celui-ci parcourt l'ARNm et assemble les différents acides aminés correspondant à la séquence des nucléotides [3], en suivant les règles du code génétique. Pour ce, le ribosome lit la séquence de l'ARNm par groupes de trois nucléotides, ou codons : chaque codon correspond à un acide aminé. Ainsi, si le ribosome lit la séquence « CCA » sur l'ARNm, il va ajouter une proline.
--> voir le lien : https://www.reseau-canope.fr/docsciences/Ribosome-et-proteines.html

Pour la définition des anticorps, voir le lien suivant:
https://www.futura-sciences.com/sante/definitions/medecine-anticorps-93/
DHEJ
Oui très intéressant @Salahtataouine
a posté le 17-11-2020 à 18:21
Des remarques remarquables en attendant la réponse.


Gg
Des Hommes ou des sous
a posté le 17-11-2020 à 18:08
L'esprit des précurseurs, Koch, Pasteur et autres Grands est bien loin. Aujourd'hui dans le monde on meurt, par dizaines de millions chaque année, de maladies facilement maîtrisées: rougeolle, typhus, poliomyélite, tuberculose, diphtérie....toutes maladies qui disposent d'un vaccin économique et transportable. On a entendu parler de 50 dollars pour les deux injections nécessaires à ces nouveaux vaccins qui doivent être stockés à -80°...comment ose t-on? Autant dire que les pays pauvres sont abandonnés au moyen âge médical, ils peuvent crever.
Ceci, et le droit de breveter le Vivant, m'écoeure profondément.
Ma femme le résume très bien: en France il y a des cliniques et des assurances pour les animaux, mes grand parents n'ont pas accès aux soins. Que répondre à cela?
La seule solution consisterait à ce que l'OMS et l'ONU créent un immense groupe de recherche et de production de médicaments, sous leur égide et de financement mondial, avec des compétences mondiales, de sorte que les brevets soient passés outre et les produits disponibles à l'humanité entière.
Mais ça....



Moderna
Logistique du vaccin de Moderna
a posté le 17-11-2020 à 18:05
Pfizer et Moderna produisent leur vaccin en utilisant la technologie ARNm. Cependant, les coûts logistiques sont différents. Le storage du vaccin de Moderna est environ moins 20 degré Celsius et non moins 70. Il peut être conservé deux mois dans un frigidaire normal. Donc, la logistique du vaccin de Moderna est beaucoup moins coûteuse que celle de Pfizer.
Article intéressant mais le discours de l'auteur est encore celui d'un "Tiers Mondiste" qui voit des complots partout. La Corée du Sud avait le même niveau de développement que la Tunisie en 1972. Fait un saut en Corée du Sud aujourd'hui et observe l'écart immense. C'était quoi la Chine début des années 1980? Ah! Misère de misère. UPS complote avec Pfizer et Moderna pour maximiser leurs profits. WOW!
Les comploteurs c'est nous. On complote contre nos propres intérêts. Un peu d'auto-crtique et un peu d'effort dans le travail et Surprise Surprise, on sera libre pour créer la richesse, innover, et développer nos propres vaccins. Arrêter de voir des complots partout. Stop tendre la main. Débarassons nous de la culture de la mendicité et tout ira bien.
salahtataouine
@Lassaâd M'sahli*
a posté le 17-11-2020 à 17:40
Article plaisant pour nous autres non initiés aux "choses scientifiques"
Mais il y a toujours un mais ..j ai suivi dès le debut ce corona machin..j ai pu comprendre un peu...oui on "travaille" sur l ARN" pour trouver un vaccin
Comme il est connu de tous l arn de ce virus a muté plusieurs fois ..il est connu qu on doit mettre une "souche" de ce virus dans un vaccin (exemple souche du virus de mars ..)mais le probleme le virus d octobre n est pas celui de mars ni celui de juin ou juillet....un jeu de dupe? on va se faire vacciner à chaque fois que le virus va muter ? un jackpot pour nos amis de la big pharma !!!
Pour ce qui est moderna et comme vous le dite c est un autre "tour" une autre facon de faire ..comme vous le savez pour chaque vaccin on doit injecter dedans "un peu de ce virus" n est ce pas ? moderna fait le jeu de l apprenti sorcier ils veulent nous injecter l arn de ce virus (ou une partie") pour que une fois injecté l ARN va produire ce virus dans notre corps mais la question qui se pose combien de virus va etre produit beaucoup ou pas assez
Le DANGER de virus de la peur veut modifier aussi notre ADN ..avec ce vaccin à la c......
@Lassaâd M'sahli* merci d avance pour votre reponse